Skip to content

bensutherland/fasta_SNP_extraction

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

78 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

fasta_SNP_extraction

Extract a section of a reference genome assembly flanking a SNP from an input tag.

Designed as part of a project with the Molecular Genetics Laboratory (MGL) at the Fisheries and Oceans Canada Pacific Biological Station (PBS).

Warning: this pipeline is provided as is, without any guarantee of usefulness.

All scripts are to be run from the main folder.
General overview:
0. Prepare input data (project-specific)

  1. BLAST search the genome
  2. Identify target range
  3. Obtain target range
  4. Rename amplicons
  5. Reverse complement necessary amplicons
  6. Select specific amplicons

0.1 Input information (example from Eulachon project)

Put original files in 02_input_data:
tpac_adaptive_loci_2018-03-22.csv
tpac_neutral_loci_2018-03-22.csv

Original format:

Loci_name,Loci_Sequence,SNP_location
Tpa_0002,GTTCGTTCAGTCTAAAGAGAATAATAGGACCGGGAGGTTTGTACTTATGTAATAGACACAC[A/T]CACATACATATGCGCA,62

Put genome contig assembly in 02_input_data/genome:
tpac_assembly/tpac_assembly_v1/tpac-contigs_min200.fa

0.1a Prepare input loci files

Concatenate input files, remove header, remove rest of line after first colon (occurs when multiple SNP locations):
cat 02_input_data/<your_markers>.csv | grep -vE 'Loci_name' - | awk -F":" '{ print $1 }' - > 02_input_data/input_loci.csv

Determine the position of the first SNP in the locus based on presence of a square bracket:
awk -F, '{ print $2 }' 02_input_data/input_loci.csv | while read l ; do echo $l | cut -d[ -f1 | wc -c ; done > 02_input_data/first_snp_position.csv note: wc -c counts the end of line character, so the position given will be truly the SNP position w/ a 1-base counting system.

Add position to the original file
paste -d, 02_input_data/input_loci.csv 02_input_data/first_snp_position.csv > 02_input_data/input_loci_w_pos.csv

Select columns of interest and put into FASTA format:
awk -F"," '{ print ">"$1"-"$4"\n"$2 }' 02_input_data/input_loci_w_pos.csv > 02_input_data/input_loci_w_pos.fa

Remove characters ([]/) to prevent issues with BLAST:
sed 's/\[//g' 02_input_data/input_loci_w_pos.fa | sed 's/\///g' - | sed 's/]//g' - > 02_input_data/input_loci_w_pos_no_badchar.fa

Rename and delete intermediate files:
mv 02_input_data/input_loci_w_pos_no_badchar.fa 02_input_data/prepared_tags.fa
mv 02_input_data/*.csv 02_input_data/input_loci_w_pos.fa 02_input_data/z-draft_input/

The output looks like this, where the accession name is '>markername-firstSNPposition':

>Tpa_0012-44
TCAGTGAGGCCCACTTCCTGGGTTTCCATCGACACACACACACCACGCTAGTGGATGGAGGGAAGGACGATTCAGGGA

0.1b Prepare genome for alignment

Fix the names of the contig assembly accessions, removing spaces, commas, '+' or dashes. Change the GENOME variable to the genome you will be using:
GENOME="./02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic.fna"; sed 's/\ /\_/g' $GENOME | cut -d, -f1 | sed 's/\+//g' - | sed 's/\-//g' - > ${GENOME%.f*}_renamed.fa

Set up genome file as a blast database GENOME="./02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic_renamed.fa; makeblastdb -in $GENOME -parse_seqids -dbtype nucl

Print name of contig, then the length of the contig (tab sep, to be used by R script below)
GENOME="02_input_data/genome/tpac-contigs_min200_renamed.fa" ; cat $GENOME | awk '$0 ~ ">" {print c; c=0;printf substr($0,2,100) "\t"; } $0 !~ ">" {c+=length($0);} END { print c; }' | tail -n+2 > 02_input_data/genome/ref_genome_seq_lengths.txt

This will be used by an Rscript below to ensure amplicon windows don't go beyond the contig size.

1. BLAST search loci against genome

Use BLAST to align the loci to the genome:
blastn -db ./02_input_data/genome/tpac-contigs_min200_renamed.fa -query ./02_input_data/prepared_tags.fa -out 03_blast_out/prepared_tags_v_tpac-contigs_outfmt6.txt -outfmt 6 -evalue 1e-20

Retain only those loci that have two or fewer hits:

# Find loci names that map more than two times:      
awk '{ print $1 }' 03_blast_out/prepared_tags_blast_outfmt6.txt | sort -n | uniq -c | sort -nk1 | awk '$1 > 2 { print $2 }' - > 03_blast_out/bad_loci.txt

# Then extract these from the BLAST output:   
grep -vf 03_blast_out/bad_loci.txt 03_blast_out/prepared_tags_blast_outfmt6.txt > 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap.txt

# Sort the BLAST output:
sort -k1,1 -k12,12gr -k11,11g -k3,3gr 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap.txt > 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap_sort.txt

Keep only a single record per accession:    
DATA="03_blast_out/prepared_tags_blast_outfmt6_rem_multimap_sort.txt" ; for i in $(cut -f1 $DATA | sort -u); do grep -w -m 1 "$i" $DATA; done > ${DATA%.txt}_single_hit.txt

2. Identify the target range within the ref genome

Use Rscript 01_scripts/identify_req_region_w_BLAST.R

This will use as inputs the single hit per blast query, and will find the target window, making sure to not go before the start of the reference contig, nor past the end of the reference contig. In these two cases, the start of the window will be the beginning or the end of the window will be the length of the contig, respectively.

This will output:
04_extraction/ranges_for_amplicon_extraction.bed
04_extraction/ranges_for_amplicon_extraction.csv

The bedfile is for extraction, the .csv gives additional useful information for determining identified positions.

3. Collect amplicons

Collect the target sequence using the bed file (from above) and the genome assembly, using bedtools:
GENOME="02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic_renamed.fa" ; bedtools getfasta -fi $GENOME -bed 04_extraction/ranges_for_amplicon_extraction.bed -fo 04_extraction/amplicon_approx_by_BLAST.fa

4. Finalize amplicons

4.1. Convert from FASTA to txt file

Turn fasta into tab separated file for ease of renaming amplicons:
awk 'BEGIN{RS=">"}{print $1"\t"$2;}' 04_extraction/amplicon_approx_by_BLAST.fa | tail -n+2 > 04_extraction/amplicon_approx_by_BLAST.txt Note: the tail -n+2 removes an empty first line (from https://www.biostars.org/p/235052/ )

4.2. Identify duplicates

Identify duplicate markers based on genomic coordinates by runnning the Rscript 01_scripts/identify_duplicates.R. This will produce the following:

  • 05_amplicons/data_suppl_all_with_duplicates.csv (all information including duplicates)
  • 05_amplicons/dropped_duplicates_suppl_info.csv (all information without duplicates)
  • 05_amplicons/dropped_duplicates.csv (simple info with mname and match.id of dropped duplicates)

4.3 Remove the preferred duplicate (non-priority markers)

Make files that contain top priority markers that you want to be sure not to remove. These should be in the format of CSV file, with mname, source where mname is the name of the marker, and the source is the name of the source for the marker. These need to all be named as 02_input_data/<source>_priority1_mnames.csv

4.4. Actually drop the duplicates

Use the script 01_scripts/drop_pref_dups_and_rename.R

Produces: 05_amplicons/all_fields.txt

4.5. Format to output to FASTA

Rename and format a fasta file with all amplicons:
awk -F"\t" '{ print ">"$1"__"$2"__"$3"__"$4"\n" $5 }' 05_amplicons/all_fields.txt | sed 's/\:/_/g' - > 05_amplicons/all_amplicons.fa Note the removal of the bed file character ':'.

This will give you names showing:

>refgenomeContigID_bedrange__queryLocus__SNPposInExtractedSegment__ForOrRevOrient    
SEQUENCESEQUENCESEQUENCE

5. Separate into forward or reverse amplicon fasta files

Select forwards and put into file:
grep -A1 '__for' 05_amplicons/all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/forward_amplicons.fa

Select reverses and put into file:
grep -A1 '__rev' 05_amplicons/all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/to_be_revcomp_amplicons.fa

Using E. Normandeau's reverse complement script ( https://github.com/enormandeau/Scripts ) fasta_reverse_comp.py ./05_amplicons/to_be_revcomp_amplicons.fa ./05_amplicons/revcomped_amplicons.fa

Combine cat 05_amplicons/forward_amplicons.fa 05_amplicons/revcomped_amplicons.fa > 05_amplicons/completed_all_amplicons.fa

6. Select only the top amplicons

Select out the top priority (1 and 2) amplicons:
cat 02_input_data/*priority*.csv | awk -F, '{ print "__"$1"__" }' - | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority_amplicons_all.fa

How many? grep -cE '^>' 05_amplicons/priority_amplicons_all.fa

Put a file into 02_input_data/ with the name <source>_priority3_mnames.csv, with two columns, csv, mname and FST. Use the following to pull these priority three out of the fasta:
awk -F, '{ print "__"$1"__" }' 02_input_data/*priority3*.csv | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority3_amplicons_all.fa

How many?
grep -cE '^>' 05_amplicons/priority3_amplicons_all.fa

Finally, put a file into 02_input_data/<source>_priority4_mnames.csv as above. This is sorted by FST. Take the number needed to make your full complement:
Currently assumed sorted with highest FST at top

How many priority amplicons do you have? cat 05_amplicons/priority*.fa | grep -cE '^>' -

awk -F, '{ print "__"$1"__" }' 02_input_data/larson_priority4_mnames.csv | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority4_amplicons_all.fa

Add all together in descending importance order, then take the number of amplicons x 2 from the fasta:
cat 05_amplicons/priority_amplicons_all.fa 05_amplicons/priority3_amplicons_all.fa 05_amplicons/priority4_amplicons_all.fa | head -n 1200 > 06_output/all_amplicons.fa

Obtain the sequence with allele information corresponding to the amplicon panel

Collect the sequence and allele information from the first step for only those in the panel:
grep -E '^>' 06_output/all_amplicons.fa | awk -F"__" '{ print $2 }' - | xargs -I{} grep {}"," 02_input_data/z-draft_input/input_loci.csv > 06_output/all_amplicons_seq_and_alleles.csv

Obtain the allele only data corresponding to the rad tags to be used in Rscript

Will need the following 'alleles only' file for the Rscript:
awk -F"[" '{ print $2 }' 06_output/all_amplicons_seq_and_alleles.csv | awk -F"]" '{ print $1 }' - | sed 's/\//,/g' - > 06_output/alleles_only.txt

Also need the text version of the amplicon panel:
awk 'BEGIN{RS=">"}{print $1"\t"$2;}' 06_output/all_amplicons.fa | tail -n+2 > 06_output/all_amplicons.txt

Then use the Rscript 01_scripts/collect_required_info_for_sub_form.R
This Rscript will merge all the collective data, including the radtags, the amplicon text, the scaffold names.

Followed by the Rscript 01_scripts/figuring_out_other_method_of_inserting_alleles.R
This Rscript will use the flanking region either before or after the SNP in the radtag file to match against the amplicon sequence, split the amplicon sequence at the expected site of the polymorphism, insert the alleles in square brackets, calculate where this insertion occurred and compare against where the insertion was expected. If they vary too much (e.g. > 5 bp), then this amplicon will be removed, as the flanking region resulted in non-specific identification of polymorphism location. Finally, only the top markers based on Fst will be retained, to a total of 600 markers. These will be output in the format required by the synthesis company.
This will finally output a file entitled 06_output/amplicon_panel_v<version_number>.csv

About

Extract a section of a reference genome flanking an input locus with SNPs.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors